| 產(chǎn)品名稱 |
pHSY15 |
| 商品貨號 |
B210686 |
| Designations |
pHSY15 |
| GenBank Number |
M97655
|
| Species |
Homo sapiens, human |
| Depositors |
B Thony |
| Vector |
Construct size (kb): 3.299999952316284 DESCRIPTION OF VECTOR COMPONENT:
Name of vector: pUC18
Intact vector size: 2.686
Type of vector: plasmid
Vector end: BamHI
Vector end: EcoRI
Cloning sites: HindIII SphI PstI SalI AccI HincII XbaI BamHI SmaI KpnI SacI
EcoRI
Polylinker sites: HindIII SphI PstI SalI AccI HincII XbaI BamHI SmaI KpnI SacI
EcoRI
Construction: pUC71K
Host range: Escherichia coli
Features (with orientation and position when available):
insert detection: lacZ', <-
MCS: HindIII...EcoRI, ->
promoter: lac, <-
replicon: pMB1, <-
marker(s): ampR, <-
Cross references: DNA Seq. Acc.: L08752 |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT:
Genome: Homo sapiens
Gene symbol: PTS
Genomic copy number: unique
Gene name: 6-pyruvoyltetrahydropterin synthase
Contains complete coding sequence?: Y
Chromosome: 11; Localization: 11 q22.3-q23.3
Tissue: liver
Type of DNA: cDNA
Insert 5' end: BamHI
Insert 3' end: EcoRI
Insert size (kb): 0.635
Cross references: DNA Seq. Acc.: M97655 Insert lengths(kb): 0.6349999904632568 Tissue: liver Gene product: 6-pyruvoyltetrahydropterin synthase [PTS] |
| Insert Size (kb) |
0.635 |
| Media |
ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin
|
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: freeze-dried |
| Comments |
Restriction digests of the clone give the following sizes (kb): BamHI/EcoRI--2.7, 0.65; BglI--2.2, 1.15; HindIII--3.35; PstI--3.35; PvuII--2.35, 1.0. Contains the complete coding sequence (nt 8-439). Constructed by amplification using the following primers incorporating BamHI and EcoRI sites: PTPS11-5'CGGGATCCATATGAGCACGGAAGGTGGTG 3' and PTPS14-5'CGGAATTCAGGATGTATATTACAAGTT 3'. |
| References |
Thony B, et al. Human 6-pyruvoyltetrahydropterin synthase: cDNA cloning and heterologous expression of the recombinant enzyme. Biochem. Biophys. Res. Commun. 189: 1437-1443, 1992. PubMed: 1282802
Beat Thony, personal communication
|
